Yum, tasty mutations...

mutation t@sting

NEVER press reload or F5 - unless you want to start from the very beginning.
Input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #1: ENST00000264734
Querying Taster for transcript #2: ENST00000456423
MT speed 0.22 s - this script 2.536282 s

Transcript summary:

Permalink

Yum, tasty mutations...

mutation t@sting

Variant:

3:190122694G>A_2_ENST00000456423

Back to summary table

Prediction:

DeleteriousPermalink

Summary:

  • Model: without_aae
  • Tree vote: 35|65 (del | benign) ?
  • Automatic classification due to ClinVar,
    tree vote conflicts with the automatic classification ?
Analysed issue Analysis result
Phys. location chr3:190122694G>A show variant in all transcripts   IGV
Gene symbol CLDN16
ExAC LOF metrics LOF: 0.03, misssense: -0.38, synonymous: -1.12
Ensembl transcript ID ENST00000456423
Genbank transcript ID
UniProt peptide N/A
Variant type Single base exchange
Gene region intron
DNA changes c.325-4998G>A
g.82365G>A
AA changes N/A
Frameshift No
Length of protein N/A
Known variant Allele 'A' was not found in ExAC, 1000G, or gnomAD.
Known disease mutation: ClinVar variation ID 5927 (pathogenic for Primary hypomagnesemia) OMIM
Known disease mutation at this position, please check HGMD for details (HGMD ID CM993497)
Phylogenetic conservation
PhyloPPhastCons
(flanking)-0.2220.992
4.2361
(flanking)4.2360.996
?
Splice sites No abrogation of potential splice sites
Distance from splice site N/A
Kozak consensus sequence altered? N/A
poly(A) signal N/A
Protein conservation N/A
Protein features N/A
AA sequence altered N/A
Chromosome 3
Strand 1
Original gDNA sequence snippet TCCGCATCTGCTTTGTTGCTGGAGCCACGTTACTAATAGCA
Altered gDNA sequence snippet TCCGCATCTGCTTTGTTGCTAGAGCCACGTTACTAATAGCA
Original cDNA sequence snippet N/A
Altered cDNA sequence snippet N/A
Wildtype AA sequence MTSRTPLLVT ACLYYSYCNS RHLQQGVRKS KRPVFSHCQV PETQKTDTRH LSGARAGVCP
CCHPDGLLAT MRDLLQYIAC FFAFFSAGFL IVATWTDCWM VNADDSLEML DLRETILIP*
Mutated AA sequence
Position of stopcodon in wt / mu CDS N/A
Position (AA) of stopcodon in wt / mu AA sequence N/A
Position of stopcodon in wt / mu cDNA N/A
Position of start ATG in wt / mu cDNA 1 / 1
Last intron/exon boundary 324
Theoretical NMD boundary in CDS 273
Length of CDS 360
Coding sequence (CDS) position N/A
cDNA position N/A
gDNA position 82365
Chromosomal position 190122694
Speed 0.03 s

All positions are in basepairs (bp) if not explicitly stated differently. cDNA/gDNA/chromosomal position: Ins/del are shown as 'last normal base / first normal base'.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

Back to summary table
Yum, tasty mutations...

mutation t@sting

Variant:

3:190122694G>A_1_ENST00000264734

Back to summary table

Prediction:

DeleteriousPermalink

Summary:

  • Model: simple_aae
  • Tree vote: 87|13 (del | benign) ?
  • Automatic classification due to ClinVar
Analysed issue Analysis result
Phys. location chr3:190122694G>A show variant in all transcripts   IGV
Gene symbol CLDN16
ExAC LOF metrics LOF: 0.03, misssense: -0.38, synonymous: -1.12
Ensembl transcript ID ENST00000264734
Genbank transcript ID
UniProt peptide Q9Y5I7
Variant type Single base exchange
Gene region CDS
DNA changes c.571G>A
g.82365G>A
AA changes G191R Score: 125 ?
Frameshift No
Length of protein Normal
Known variant Allele 'A' was not found in ExAC, 1000G, or gnomAD.
Known disease mutation: ClinVar variation ID 5927 (pathogenic for Primary hypomagnesemia) OMIM
Known disease mutation at this position, please check HGMD for details (HGMD ID CM993497)
Phylogenetic conservation
PhyloPPhastCons
(flanking)-0.2220.992
4.2361
(flanking)4.2360.996
?
Splice sites No abrogation of potential splice sites
Distance from splice site 22
Kozak consensus sequence altered? No
poly(A) signal N/A
Protein conservation
SpeciesMatchGeneAAAlignment
Human      191PYIKVRICFVAGATLLIAGTPGII
mutated  not conserved    191YIKVRICFVARATLLIAGTPGI
Ptroglodytes  all identical  ENSPTRG00000015739  191YIKVRICFVAGTTLLIAGTPGI
Mmulatta  all identical  ENSMMUG00000018671  121GTTLLIAGTPGI
Fcatus  all identical  ENSFCAG00000003329  121GTILLIAGAPGI
Mmusculus  all identical  ENSMUSG00000038148  121GTTLLIAGTPGI
Ggallus  all identical  ENSGALG00000025821  121GVTLLIAGLPGI
Trubripes  no homologue    
Drerio  no homologue    
Dmelanogaster  no homologue    
Celegans  no homologue    
Xtropicalis  all identical  ENSXETG00000015045  121GITLLIGGVPGI
Protein features
Start (aa)End (aa)FeatureDetails 
186206TRANSMEM Helical lost
AA sequence altered Yes
Chromosome 3
Strand 1
Original gDNA sequence snippet TCCGCATCTGCTTTGTTGCTGGAGCCACGTTACTAATAGCA
Altered gDNA sequence snippet TCCGCATCTGCTTTGTTGCTAGAGCCACGTTACTAATAGCA
Original cDNA sequence snippet TCCGCATCTGCTTTGTTGCTGGAGCCACGTTACTAATAGCA
Altered cDNA sequence snippet TCCGCATCTGCTTTGTTGCTAGAGCCACGTTACTAATAGCA
Wildtype AA sequence MTSRTPLLVT ACLYYSYCNS RHLQQGVRKS KRPVFSHCQV PETQKTDTRH LSGARAGVCP
CCHPDGLLAT MRDLLQYIAC FFAFFSAGFL IVATWTDCWM VNADDSLEVS TKCRGLWWEC
VTNAFDGIRT CDEYDSILAE HPLKLVVTRA LMITADILAG FGFLTLLLGL DCVKFLPDEP
YIKVRICFVA GATLLIAGTP GIIGSVWYAV DVYVERSTLV LHNIFLGIQY KFGWSCWLGM
AGSLGCFLAG AVLTCCLYLF KDVGPERNYP YSLRKAYSAA GVSMAKSYSA PRTETAKMYA
VDTRV*
Mutated AA sequence MTSRTPLLVT ACLYYSYCNS RHLQQGVRKS KRPVFSHCQV PETQKTDTRH LSGARAGVCP
CCHPDGLLAT MRDLLQYIAC FFAFFSAGFL IVATWTDCWM VNADDSLEVS TKCRGLWWEC
VTNAFDGIRT CDEYDSILAE HPLKLVVTRA LMITADILAG FGFLTLLLGL DCVKFLPDEP
YIKVRICFVA RATLLIAGTP GIIGSVWYAV DVYVERSTLV LHNIFLGIQY KFGWSCWLGM
AGSLGCFLAG AVLTCCLYLF KDVGPERNYP YSLRKAYSAA GVSMAKSYSA PRTETAKMYA
VDTRV*
Position of stopcodon in wt / mu CDS 918 / 918
Position (AA) of stopcodon in wt / mu AA sequence 306 / 306
Position of stopcodon in wt / mu cDNA 1166 / 1166
Position of start ATG in wt / mu cDNA 249 / 249
Last intron/exon boundary 1032
Theoretical NMD boundary in CDS 733
Length of CDS 918
Coding sequence (CDS) position 571
cDNA position 819
gDNA position 82365
Chromosomal position 190122694
Speed 0.19 s

All positions are in basepairs (bp) if not explicitly stated differently. cDNA/gDNA/chromosomal position: Ins/del are shown as 'last normal base / first normal base'.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

Back to summary table